WormBase Tree Display for Variation: WBVar00251491

WBVar00251491 Name: Public_name: tm2639
    Other_name: T05C12.6c.1:c.238_896+59delinsAATAT
      CE02318:p.Gln80AsnfsTer4
      T05C12.6a.1:c.238_913delinsAATAT
      CE25100:p.Gln80AsnfsTer4
      T05C12.6b.1:c.238_913delinsAATAT
    HGVSg: CHROMOSOME_II:g.8183841_8184651delinsATATT
  Sequence_details: SMap: S_parent: Sequence: T05C12
    Flanking_sequences: cacttggggcacctcttgcaaacttactga ggatttgcgcagccgatccgaatcagttgt
    Mapping_target: T05C12
    Source_location: 7 CHROMOSOME_II 8183840 8184652 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ATATT
      Deletion
    PCR_product: tm2639_external
      tm2639_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2639
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003241
    Transcript: T05C12.6b.1 (11)
      T05C12.6a.1 (11)
      T05C12.6c.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T05C12.6c.1:c.238_896+59delinsAATAT
        cDNA_position: 253-?
        CDS_position: 238-?
        Protein_position: 80-?
        Intron_number: 4-6/9
        Exon_number: 4-6/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000188 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: some animals have one or no gonadal arms Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000469 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: QL cell migration abnormal Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: not Psa Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 15686/15687-ATATT-16497/16498 (811 bp deletion + 5 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele