WormBase Tree Display for Variation: WBVar00251462
expand all nodes | collapse all nodes | view schema
WBVar00251462 | Name | Public_name | tm2604 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C01H6.3.1:c.113_244+90del | |||||||
HGVSg | CHROMOSOME_I:g.7209300_7209574del | |||||||
Sequence_details | SMap | S_parent | Sequence | C01H6 | ||||
Flanking_sequences | cttttaagtcatattgattatacactggtt | tttcttgctctaagattttgtgcattgact | ||||||
Mapping_target | C01H6 | |||||||
Source_location | 7 | CHROMOSOME_I | 7209299 | 7209575 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2604_external | |||||||
tm2604_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2604 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007253 | ||||||
Transcript | C01H6.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C01H6.3.1:c.113_244+90del | |||||||
cDNA_position | 293-? | |||||||
CDS_position | 113-? | |||||||
Protein_position | 38-? | |||||||
Intron_number | 2-3/5 | |||||||
Exon_number | 2-3/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000315 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Chalfie: normal touch sensitivity. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | 17495/17496-17770/17771 (275 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |