WormBase Tree Display for Variation: WBVar00251348
expand all nodes | collapse all nodes | view schema
WBVar00251348 | Name | Public_name | tm2464 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | B0395.2.1:c.683+8_684-4del | |||||||
HGVSg | CHROMOSOME_X:g.16032785_16032986del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0395 | ||||
Flanking_sequences | atttatagggacagctatccgaggtattcc | cagaactgaaaaacgtgatatgaaagccgc | ||||||
Mapping_target | B0395 | |||||||
Source_location | 7 | CHROMOSOME_X | 16032784 | 16032987 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2464_external | |||||||
tm2464_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2464 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007174 | ||||||
Transcript | B0395.2.1 | VEP_consequence | splice_region_variant,intron_variant | |||||
VEP_impact | LOW | |||||||
HGVSc | B0395.2.1:c.683+8_684-4del | |||||||
Intron_number | 6/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. T. Kurzchalia: non CDS mutant and does not affect the gene. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000886 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. T. Kurzchalia to National Bioresource Project of Japan: non CDS mutant and does not affect the gene. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 13665/13666-13867/13868 (202 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |