WormBase Tree Display for Variation: WBVar00251332

WBVar00251332 Name: Public_name: tm2446
    Other_name: Y69A2AR.29.1:c.327-120_473del
    HGVSg: CHROMOSOME_IV:g.2626262_2626528del
  Sequence_details: SMap: S_parent: Sequence: Y69A2AR
    Flanking_sequences: gacggtggattactgtaggatgaggggtac taaaaagttgagaaagtggctcagtcgggt
    Mapping_target: Y69A2AR
    Source_location: 7 CHROMOSOME_IV 2626261 2626529 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2446_external
      tm2446_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2446
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003595
    Transcript: Y69A2AR.29.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y69A2AR.29.1:c.327-120_473del
        cDNA_position: ?-530
        CDS_position: ?-473
        Protein_position: ?-158
        Intron_number: 3/4
        Exon_number: 4/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000565 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. D. Portamn to the National Bioresource Project of Japan: Unc (sluggish with a tendency to coil). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: UR
        Penetrance: Incomplete: Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson48
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. J. Kaplan: Unc. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KP
      WBPhenotype:0000646 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. D. Portamn to the National Bioresource Project of Japan: Unc (sluggish with a tendency to coil). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: UR
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. J. Kaplan: non-Egl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KP
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. T. Schedl: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: BS
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. T. Schedl: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: BS
  Remark: 142346/142347-142613/142614 (267 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele