WormBase Tree Display for Variation: WBVar00251330

WBVar00251330 Name: Public_name: tm2443
    Other_name: CE49542:p.Ile158MetfsTer31
      C33H5.15b.1:c.474_623delinsGAGAAAA
      CE34732:p.Ile158MetfsTer31
      C33H5.15b.2:c.474_623delinsGAGAAAA
      C33H5.15a.1:c.474_623delinsGAGAAAA
    HGVSg: CHROMOSOME_IV:g.7795383_7795586delinsTTTTCTC
  Sequence_details: SMap: S_parent: Sequence: C33H5
    Flanking_sequences: tttgttggaattgtagatgcttcttcgaca atttctccttgcatagaagactgacaaaat
    Mapping_target: C33H5
    Source_location: 7 CHROMOSOME_IV 7795382 7795587 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTTTCTC
      Deletion
    PCR_product: tm2443_external
      tm2443_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005205
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2443
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016381
    Transcript: C33H5.15a.1 (11)
      C33H5.15b.2 (11)
      C33H5.15b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000150 Paper_evidence: WBPaper00066239
        Curator_confirmed: WBPerson557
        Remark: Note, this phenotype is not rescued by sSgo1 (a shorter splice variant of human Sgo1). Paper_evidence: WBPaper00066239
            Curator_confirmed: WBPerson557
      WBPhenotype:0000663 Paper_evidence: WBPaper00066239
        Curator_confirmed: WBPerson557
        Remark: The avoidance behavior to 3M glycerol is significantly decreased compared to control animals. Note, this phenotype is not rescued by sSgo1 (a shorter splice variant of human Sgo1). Paper_evidence: WBPaper00066239
            Curator_confirmed: WBPerson557
      WBPhenotype:0001378 Paper_evidence: WBPaper00032269
        Curator_confirmed: WBPerson712
        Remark: Very low penetrance of segregation defects such as chromosome bridges were observed. Paper_evidence: WBPaper00032269
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. M. Colaiacovo to the National Bioresource Project of Japan: no embryonic lethality at 20 or 25 C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000313 Paper_evidence: WBPaper00032269
        Curator_confirmed: WBPerson712
        Remark: Cytological analysis of DAPI-stained germlines from mutant worms revealed six bivalents like that observed in wild type. Paper_evidence: WBPaper00032269
            Curator_confirmed: WBPerson712
      WBPhenotype:0000436 Paper_evidence: WBPaper00032269
        Curator_confirmed: WBPerson712
        Remark: AIR-2 is observed occupying the short arms of the bivalents in 99% of nuclei observed (n=73). Histone H3 phosphorylation signal and the localization of AIR-2 and LAB-1 on metaphase I bivalents of mutant worms were indistinguishable from wild type. Paper_evidence: WBPaper00032269
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. M. Colaiacovo to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
      WBPhenotype:0000775 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. M. Colaiacovo to the National Bioresource Project of Japan: No meiotic prophase defects observed on DAPI-stained gonads. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
      WBPhenotype:0001175 Paper_evidence: WBPaper00048917
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
          WBPerson721
        Remark: Comment from Dr. M. Colaiacovo to the National Bioresource Project of Japan: no apparent Him at 20 or 25 C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. H. Sawa to the National Bioresource Project of Japan: not Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
      WBPhenotype:0001963 Paper_evidence: WBPaper00032269
        Curator_confirmed: WBPerson712
        Remark: Homolog association was normal at diakinesis. Moreover, no defects in homolog association or premature loss of sister chromatid cohesion were detected at metaphase I. Paper_evidence: WBPaper00032269
            Curator_confirmed: WBPerson712
  Reference: WBPaper00032269
    WBPaper00048917
    WBPaper00066239
  Remark: 21762/21763-TTTTCTC-21966/21967 (204 bp deletion + 7 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele