WormBase Tree Display for Variation: WBVar00251274

WBVar00251274 Name: Public_name: tm2385
    Other_name: F39C12.4.1:c.79_231+8del
    HGVSg: CHROMOSOME_X:g.4866189_4866405del
  Sequence_details: SMap: S_parent: Sequence: F39C12
    Flanking_sequences: gctagtgcttgtttcctgaactcttgtccg ttagcatgttgaaataagtaataatgtgac
    Mapping_target: F39C12
    Source_location: 7 CHROMOSOME_X 4866188 4866406 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2385_external
      tm2385_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2385
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00044568
    Transcript: F39C12.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F39C12.4.1:c.79_231+8del
        cDNA_position: 92-?
        CDS_position: 79-?
        Protein_position: 27-?
        Intron_number: 2-3/5
        Exon_number: 2-3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000154 Paper_evidence: WBPaper00053007
        Curator_confirmed: WBPerson39110
        Remark: reduction in reproductive capacity Paper_evidence: WBPaper00053007
            Curator_confirmed: WBPerson39110
      WBPhenotype:0001444 Paper_evidence: WBPaper00041683
        Curator_confirmed: WBPerson11490
      WBPhenotype:0001983 Paper_evidence: WBPaper00053007
        Curator_confirmed: WBPerson39110
        Remark: Progeny enhanced food leaving is observed in N2 wild type. ntc-1(tm2385) mutant is deficient in this enhanced food leaving Paper_evidence: WBPaper00053007
            Curator_confirmed: WBPerson39110
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment from Dr. C. Bargmann to the NBP: viable Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: fertile Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00041683
    WBPaper00053007
  Remark: 31393/31394-31610/31611 (217 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele