WormBase Tree Display for Variation: WBVar00251170
expand all nodes | collapse all nodes | view schema
WBVar00251170 | Name | Public_name | tm2256 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T05D4.4a.1:c.601-51_680delinsTC | |||||||
T05D4.4b.1:c.601-51_680delinsTC | ||||||||
HGVSg | CHROMOSOME_III:g.13577632_13577762delinsTC | |||||||
Sequence_details | SMap | S_parent | Sequence | T05D4 | ||||
Flanking_sequences | ttttctgacagtttgtgaattcaagaagta | tccagttgtgcaaagattctgtaatccacc | ||||||
Mapping_target | T05D4 | |||||||
Source_location | 7 | CHROMOSOME_III | 13577631 | 13577763 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | TC | ||||||
Deletion | ||||||||
PCR_product | tm2256_external | |||||||
tm2256_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008300 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2256 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003887 | ||||||
Transcript (2) | ||||||||
Interactor | WBInteraction000500645 | |||||||
WBInteraction000500656 | ||||||||
WBInteraction000500658 | ||||||||
WBInteraction000500659 | ||||||||
WBInteraction000500660 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals had a lower arousal threshold to mechanosensory stimuli than control animals; animals responded more frequently to stimuli than control quiescent animals. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals took significantly more time to respond to octanol (initiate backwards movement) than WT controls. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001966 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited increased basal locomotion activity, twice the number of body bends per minute than observed for control animals. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00038400 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited increased L4/A quiescence compared to control animals. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000249 | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals fail to avoid high osmolarity. | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype (2) | |||||||
WBPhenotype:0001096 | Paper_evidence | WBPaper00032102 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype (2) | |||||||
Phenotype_assay | Genotype | ayIs4 | Paper_evidence | WBPaper00032102 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038400 | |||||||
WBPaper00032102 | ||||||||
Remark | 23507/23508-TC-23638/23639 (131 bp deletion + 2 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |