WormBase Tree Display for Variation: WBVar00251019

WBVar00251019 Name: Public_name: tm2074
    HGVSg
  Sequence_details: SMap: S_parent: Sequence: M18
    Flanking_sequences: ttttcttactttgaattattatttgaaaaa tttgtctcttgaggacatcatctctaaaac
    Mapping_target: M18
    Source_location: 7 CHROMOSOME_IV 12122955 12123337 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GNNTNTCCGAT
      Deletion
    PCR_product: tm2074_external
      tm2074_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2074
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000122
    Transcript: M18.7a.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-55
        CDS_position: ?-23
        Protein_position: ?-8
        Exon_number: 1-2/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
    Mapping_data: In_multi_point: 5514
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 22912/22913-GNNTNTCCGAT-23293/23294 (381 bp deletion + 11 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele