WormBase Tree Display for Variation: WBVar00251006

WBVar00251006 Name: Public_name: tm2060
    Other_name: K02D10.5.1:c.224_391-28delinsGT
    HGVSg: CHROMOSOME_III:g.8776588_8777011delinsGT
  Sequence_details: SMap: S_parent: Sequence: K02D10
    Flanking_sequences: agaaaatcggaacgtcgactgctcagcagt tacgtcataaaattgatatatttataggtc
    Mapping_target: K02D10
    Source_location: 7 CHROMOSOME_III 8776587 8777012 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GT
      Deletion
    PCR_product: tm2060_external
      tm2060_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2060
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019305
    Transcript: K02D10.5.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K02D10.5.1:c.224_391-28delinsGT
        cDNA_position: 237-?
        CDS_position: 224-?
        Protein_position: 75-?
        Intron_number: 3/5
        Exon_number: 3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. M. Nonet: variable arrest embryonic lethal phenotype, usually before comma stage; Dr. J. Lee: Emb. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: NM
              LJ
      WBPhenotype:0000055 Paper_evidence: WBPaper00038394
        Curator_confirmed: WBPerson3541
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000063 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Nonet to the National Bioresource Project of Japan: variable arrest embryonic lethal phenotype, usually before comma stage. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: NM
      WBPhenotype:0000668 Paper_evidence: WBPaper00038394
        Curator_confirmed: WBPerson3541
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000724 Paper_evidence: WBPaper00038394
        Curator_confirmed: WBPerson3541
  Reference: WBPaper00038394
  Remark: 7830/7831-GT-8254/8255 (424 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele