WormBase Tree Display for Variation: WBVar00251004

WBVar00251004 Name: Public_name: tm2058
    HGVSg: CHROMOSOME_III:g.11311211_11311690delinsAA
  Sequence_details: SMap: S_parent: Sequence: Y47D3A
    Flanking_sequences: atcggataaatcagaatttcgatggaaaaa aaataaaaattacacttgaaaattttttaa
    Mapping_target: Y47D3A
    Source_location: 7 CHROMOSOME_III 11311210 11311691 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AA
      Deletion
    PCR_product: tm2058_external
      tm2058_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2058
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004284
    Transcript: Y47D3A.25.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/6
        Exon_number: 1-2/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
    Mapping_data: In_multi_point: 5669
  Description: Phenotype_not_observed: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. Y. Jin: grows well. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CZ
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000180 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. Y. Jin: normal motor and touch axons Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CZ
      WBPhenotype:0000616 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. Y. Jin: normal synapses Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: CZ
      WBPhenotype:0001686 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. S. Eimer: does not affect levamisole receptor trafficking. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: GQ
        Affected_by: Molecule: WBMol:00004019 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
  Remark: 175060/175061-AA-175540/175541 (380 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele