WormBase Tree Display for Variation: WBVar00250956
expand all nodes | collapse all nodes | view schema
WBVar00250956 | Name | Public_name | tm1996 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.6912039_6912626del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T07E3 | |||||
Flanking_sequences | tgagaaatctaactttcttggacggtcaag | ttggccatgaacttatcaattttcaatcga | |||||||
Mapping_target | T07E3 | ||||||||
Source_location | 7 | CHROMOSOME_III | 6912038 | 6912627 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm1996_external | ||||||||
tm1996_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026308 | ||||||||
WBStrain00026321 | |||||||||
WBStrain00031072 | |||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1996 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00020317 | |||||||
Transcript | T07E3.6a.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2/4 | ||||||||
Exon_number | 1-2/5 | ||||||||
T07E3.6b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2/5 | ||||||||
Exon_number | 1-2/6 | ||||||||
T07E3.6a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2/5 | ||||||||
Exon_number | 1-2/6 | ||||||||
Interactor | WBInteraction000519222 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype | WBPhenotype:0000067 | Paper_evidence | WBPaper00065376 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pdf-1 null mutants "...showed a decreased survivability against thermal stress at 5-day-old adult stage (Figure 1E and 1F)." | Paper_evidence | WBPaper00065376 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 35 | Paper_evidence | WBPaper00065376 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000888 | Paper_evidence | WBPaper00048673 | |||||||
Curator_confirmed | WBPerson2817 | ||||||||
Remark | pdf-1 (tm1996) defective in male-specific sexual conditioning | Paper_evidence | WBPaper00048673 | ||||||
Curator_confirmed | WBPerson2817 | ||||||||
WBPhenotype:0001506 | Paper_evidence | WBPaper00031656 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit a 3-fold increase in reversal frequency compared with N2. | Paper_evidence | WBPaper00031656 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001713 | Paper_evidence | WBPaper00047014 | |||||||
Curator_confirmed | WBPerson30438 | ||||||||
Remark | pdf-1 mutant did not show diurnal or circadian rhythms under LD or DD conditions, respectively (Fig. 1b) | Paper_evidence | WBPaper00047014 | ||||||
Curator_confirmed | WBPerson30438 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00047014 | |||||
Curator_confirmed | WBPerson30438 | ||||||||
WBPhenotype:0001715 | Paper_evidence | WBPaper00031656 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed an increase in the frequency of directional changes compared with N2. | Paper_evidence | WBPaper00031656 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001717 | Paper_evidence | WBPaper00031656 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals displayed a significant decrease in centroid velocity compared with N2 animals. Animals exhibited movements that were ~50% slower than N2. | Paper_evidence | WBPaper00031656 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002128 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant males remain on food in the absence of mates. Males had no drive to explore away from food. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006814 | PATO:0000460 | Paper_evidence | WBPaper00041718 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00041718 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002130 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002317 | Paper_evidence | WBPaper00044094 | |||||||
Curator_confirmed | WBPerson23309 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00041718 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants were able to successfully mate, although they did not respond as avidly as wild-type males to mate contact. | Paper_evidence | WBPaper00041718 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00065376 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In agreement with the flp-2 null mutant results, pdf-1 null mutants also exhibited a normal lifespan (Figure 1A and 1B), and stress tolerance against paraquat (Figure 1C and 1D). | Paper_evidence | WBPaper00065376 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. S. Husson: J. Biol. Chem. 283, 15241 (2008). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000460 | Paper_evidence | WBPaper00065376 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In agreement with the flp-2 null mutant results, pdf-1 null mutants also exhibited a normal lifespan (Figure 1A and 1B), and stress tolerance against paraquat (Figure 1C and 1D). | Paper_evidence | WBPaper00065376 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00065376 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00041718 | ||||||||
WBPaper00031656 | |||||||||
WBPaper00044094 | |||||||||
WBPaper00047014 | |||||||||
WBPaper00048673 | |||||||||
WBPaper00065376 | |||||||||
Remark | 14212/14213-14800/14801 (588 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |