WormBase Tree Display for Variation: WBVar00250944
expand all nodes | collapse all nodes | view schema
WBVar00250944 | Name | Public_name | tm1984 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.4651984_4653585del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0041 | ||||
Flanking_sequences | gcggcggaaagaggacagtggaattggaat | attatttttcaggcaatgatccgaattatc | ||||||
Mapping_target | B0041 | |||||||
Source_location | 7 | CHROMOSOME_I | 4651983 | 4653586 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1984_external | |||||||
tm1984_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00024115 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1984 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015007 | ||||||
WBGene00015010 | ||||||||
Transcript | B0041.6b.1 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1-2/2 | |||||||
Exon_number | 1-3/3 | |||||||
B0041.2e.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2/10 | |||||||
Exon_number | 1-2/11 | |||||||
B0041.2f.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2/10 | |||||||
Exon_number | 1-2/11 | |||||||
B0041.6a.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1-2/3 | |||||||
Exon_number | 1-4/4 | |||||||
B0041.2d.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/8 | |||||||
Exon_number | 1/9 | |||||||
B0041.2a.1 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/10 | |||||||
Exon_number | 1/11 | |||||||
B0041.2b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2/10 | |||||||
Exon_number | 1-2/11 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Mapping_data | In_multi_point | 5492 | ||||||
Description | Phenotype | WBPhenotype:0000224 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Loer to the National Bioresource Project of Japan: the same phenotype as cat-4; serotonin deficient and bleach hypersensitive. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | LC | |||||||
WBPhenotype:0000586 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Loer to the National Bioresource Project of Japan: the same phenotype as cat-4; serotonin deficient and bleach hypersensitive. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | LC | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 8846/8847-10448/10449 (1602 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |