WormBase Tree Display for Variation: WBVar00250929

WBVar00250929 Name: Public_name: tm1969
    HGVSg: CHROMOSOME_I:g.4114594_4115015delinsGAGGGAGAGAAAAAT
  Sequence_details: SMap: S_parent: Sequence: H31G24
    Flanking_sequences: taaatttattgataatctagacttgaaatt gaggaagagttcaattgcatggctgaagac
    Mapping_target: H31G24
    Source_location: 7 CHROMOSOME_I 4114593 4115016 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GAGGGAGAGAAAAAT
      Deletion
    PCR_product: tm1969_external
      tm1969_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1969
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000867
    Transcript: H31G24.4.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-155
        CDS_position: ?-138
        Protein_position: ?-46
        Exon_number: 1-2/6
    Interactor: WBInteraction000525088
      WBInteraction000525089
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
    Mapping_data: In_multi_point: 5273
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Kimble to the National Bioresource Project of Japan: homozygotes are viable. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              JK
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Subramaniam: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: IT
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Kimble to the National Bioresource Project of Japan: homozygotes are fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: JK
  Remark: 2098/2099-GAGGGAGAGAAAAAT-2520/2521 (422 bp deletion + 15 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele