WormBase Tree Display for Variation: WBVar00250898

WBVar00250898 Name: Public_name: tm1937
    HGVSg: CHROMOSOME_I:g.4264898_4266089del
  Sequence_details: SMap: S_parent: Sequence: C43E11
    Flanking_sequences: gacttaccgtaaattcaaatgttttattac atattcaggagtactgtagctcccaactcc
    Mapping_target: C43E11
    Source_location: 7 CHROMOSOME_I 4264897 4266090 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1937_external
      tm1937_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00034679
      WBStrain00034681
      WBStrain00034682
      WBStrain00034697
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1937
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016602
    Transcript: C43E11.2b.2 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-687
        Exon_number: 1/4
      C43E11.2b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-877
        Intron_number: 1-2/5
        Exon_number: 1-3/6
      C43E11.2a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 1-3/5
        Exon_number: 1-3/6
      C43E11.2b.3 VEP_consequence: splice_donor_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 1/4
        Exon_number: 1/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000031 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: slow growing. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
      WBPhenotype:0000585 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: spontaneous DNA damage in the mitotic compartment of the germline. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
      WBPhenotype:0000631 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Boulton to the National Bioresource Project of Japan: sensitive to cisplatin. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: DW
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. A. Fraser: no synthetic phenotype with Y47G6A.8 (RNAi), Y56A3A.27 (RNAi) and T04A11.6 (RNAi); Dr. S. Boulton: EMBO J. 26, 3384 (2007). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001760 Paper_evidence: WBPaper00031945
        Curator_confirmed: WBPerson712
        Remark: MonoG or G-tracts were not deleted at an increased rate as demonstrated by lack of expression of B-galactosidase, which acted as an indicator of a DNA rearrangement bringing a LacZ start codon in-frame with the downstream ORF. No increase in deletion frequency over wild-type was observed for the endogenous qua375 sequence as determined by PCR. At least 24 populations of 5 animals were assayed. Paper_evidence: WBPaper00031945
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: pkIs2165[pRP1878: hsp-16.41::ATG-(C)23-stops-LacZ unc-119] or pkIs2172 [pRP1889: hsp-16.41::ATG-(monoA)-stops-LacZ unc-119] Paper_evidence: WBPaper00031945
              Curator_confirmed: WBPerson712
      WBPhenotype:0002535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Leroux to the National Bioresource Project of Japan: Dyf normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MX
  Reference: WBPaper00031945
  Remark: 35894/35895-37086/37087 (1192 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele