WormBase Tree Display for Variation: WBVar00250895
expand all nodes | collapse all nodes | view schema
WBVar00250895 | Name | Public_name | tm1934 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F54G2.1g.1:c.947_1565delinsGTTTG | |||||||
CE53218:p.Gln316ArgfsTer13 | ||||||||
CE53421:p.Gln358ArgfsTer13 | ||||||||
F54G2.1d.1:c.1073_1691delinsGTTTG | ||||||||
F54G2.1f.1:c.947_1565delinsGTTTG | ||||||||
CE37652:p.Gln438ArgfsTer13 | ||||||||
F54G2.1e.1:c.1073_1691delinsGTTTG | ||||||||
CE53311:p.Gln358ArgfsTer13 | ||||||||
F54G2.1a.1:c.1313_1931delinsGTTTG | ||||||||
CE53175:p.Gln316ArgfsTer13 | ||||||||
HGVSg | CHROMOSOME_X:g.2625721_2626780delinsCAAAC | |||||||
Sequence_details | SMap | S_parent | Sequence | F54G2 | ||||
Flanking_sequences | gggtcttgcactgattcgatgctccgatct | gaagagtgaaccattgctccaaaccgtccg | ||||||
Mapping_target | F54G2 | |||||||
Source_location | 7 | CHROMOSOME_X | 2625720 | 2626781 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CAAAC | ||||||
Deletion | ||||||||
PCR_product | tm1934_external | |||||||
tm1934_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1934 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018837 | ||||||
Transcript | F54G2.1e.1 (11) | |||||||
F54G2.1a.1 (11) | ||||||||
F54G2.1g.1 (11) | ||||||||
F54G2.1d.1 (11) | ||||||||
F54G2.1f.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000017 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. J. Kaplan: slight resistant to aldicarb. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KP | |||||||
Affected_by | Molecule | WBMol:00003650 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001012 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. J. Kaplan: normal response to pathogen. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KP | |||||||
Remark | 9094/9095-CAAAC-10154/10155 (1060 bp deletion + 5 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |