WormBase Tree Display for Variation: WBVar00250848

WBVar00250848 Name: Public_name: tm1885
    Other_name (13)
    HGVSg: CHROMOSOME_I:g.8206055_8207016del
  Sequence_details: SMap: S_parent: Sequence: T02E1
    Flanking_sequences: cgtaactttgatcatgagctattagcagat aatcatgatgttcttccgattgtattggct
    Mapping_target: T02E1
    Source_location: 7 CHROMOSOME_I 8206054 8207017 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1885_external
      tm1885_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1885
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00008570
    Transcript (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: non Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: HS
  Remark: [T02E1] 2386/2387-[T02E1] 3348/3349 (962 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele