WormBase Tree Display for Variation: WBVar00250754
expand all nodes | collapse all nodes | view schema
WBVar00250754 | Name | Public_name | tm1789 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_II:g.5525057_5525978del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK177 | ||||
Flanking_sequences | ttatgatttgaaactttatcgtattcagtc | gggtatacgctatacttatccagttcgaag | ||||||
Mapping_target | ZK177 | |||||||
Source_location | 7 | CHROMOSOME_II | 5525056 | 5525979 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1789_external | |||||||
tm1789_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (7) | ||||||||
Affects | Gene | WBGene00006554 | ||||||
Transcript | ZK177.10.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-293 | |||||||
CDS_position | ?-275 | |||||||
Protein_position | ?-92 | |||||||
Intron_number | 2/5 | |||||||
Exon_number | 1-3/6 | |||||||
Interactor | WBInteraction000502409 | |||||||
WBInteraction000502410 | ||||||||
WBInteraction000502411 | ||||||||
WBInteraction000542315 | ||||||||
WBInteraction000542316 | ||||||||
WBInteraction000542317 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Maduro: Development 133, 3097-3106 (2006). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000111 | Paper_evidence | WBPaper00034727 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Absence of ceh-22::GFP expression in part of the posterior pharynx in tbx-35 mutants | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Maduro: Development 133, 3097-3106 (2006). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00034727 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Weaker ceh-51 expression still occurred in approximately half of tbx-35(tm1789) mutants. In vivo expression of a minimal ceh-51::GFP reporter was abolished in a tbx-35(tm1789) background | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001525 | Paper_evidence | WBPaper00034727 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | tbx-35(tm1789) larvae displayed grinder abnormalities and a defective terminal bulb at 15C. | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00034727 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000493 | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | tbx-35(tm1789) larvae showed a well-defined metacorpus | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001046 | Paper_evidence | WBPaper00034727 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | tbx-35(tm1789) larvae showed less disorganized muscle actin | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00034727 | |||||||
Remark | 23636/23637-24558/24559 (922 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |