WormBase Tree Display for Variation: WBVar00250677
expand all nodes | collapse all nodes | view schema
WBVar00250677 | Name | Public_name | tm1706 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (11) | ||||||||
HGVSg | CHROMOSOME_I:g.12526224_12526772delinsCC | |||||||
Sequence_details | SMap | S_parent | Sequence | K11D2 | ||||
Flanking_sequences | atgtcaatattgccccaaaaaagtcaatag | ggccgctcattccgtcaacgttcgcaacaa | ||||||
Mapping_target | K11D2 | |||||||
Source_location | 7 | CHROMOSOME_I | 12526223 | 12526774 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | CCC | ||||||
Deletion | ||||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1706 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00010770 | ||||||
Transcript (6) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. W. Schafer to the National Bioresource Project of Japan: locomotion grossly normal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. W. Schafer to the National Bioresource Project of Japan: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 25569/25570-CCC-26119/26120 (550 bp deletion + 3 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |