WormBase Tree Display for Variation: WBVar00250590

WBVar00250590 Name: Public_name: tm1610
    Other_name: Y71H9A.2.1:c.513_*4del
    HGVSg: CHROMOSOME_X:g.11635080_11636340del
  Sequence_details: SMap: S_parent: Sequence: Y71H9A
    Flanking_sequences: tacagaaatgttatctgatcgtgatgtcat gaaactctttccgaatcttccctttttttc
    Mapping_target: Y71H9A
    Source_location: 7 CHROMOSOME_X 11635079 11636341 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1610_external
      tm1610_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1610
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006068
    Transcript: Y71H9A.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y71H9A.2.1:c.513_*4del
        cDNA_position: 526-914
        CDS_position: 513-?
        Protein_position: 171-?
        Intron_number: 5-9/10
        Exon_number: 5-11/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. C. Hunter: normal growth Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000315 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Chalfie: non-Mec. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: TU
      WBPhenotype:0000518 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. C. Hunter: normal developement at 20C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000625 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
          WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Shen: normal synapse formation as determined by VAMP::YFP localization to presynaptic sites in HSNL. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
              WBPerson48
            Laboratory_evidence: FX
        EQ_annotations: Anatomy_term: WBbt:0006830 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
            WBbt:0004758 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
  Remark: 11236/11237-12497/12498 (1261 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele