WormBase Tree Display for Variation: WBVar00250589

WBVar00250589 Name: Public_name: tm1608
    Other_name: Y71H9A.2.1:c.782+144_783-206delinsG
    HGVSg: CHROMOSOME_X:g.11635676_11635969delinsG
  Sequence_details: SMap: S_parent: Sequence: Y71H9A
    Flanking_sequences: atgtggcagtttttgcttttaattttgctt ttatacaatttcaattatttttggcataag
    Mapping_target: Y71H9A
    Source_location: 7 CHROMOSOME_X 11635675 11635970 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: G
      Deletion
    PCR_product: tm1608_external
      tm1608_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1608
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006068
    Transcript: Y71H9A.2.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y71H9A.2.1:c.782+144_783-206delinsG
        Intron_number: 8/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000315 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Chalfie: non-Mec. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 11832/11833-G-12126/12127 (294 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele