WormBase Tree Display for Variation: WBVar00250571
expand all nodes | collapse all nodes | view schema
WBVar00250571 | Name | Public_name | tm1586 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (3) | ||||||||
HGVSg | CHROMOSOME_II:g.9624844_9625370del | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | tttcaagataaaaatccctattggctccac | gaaagttgcaagatgaacatagaaatcaat | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 7 | CHROMOSOME_II | 9624843 | 9625371 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1586_external | |||||||
tm1586_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1586 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00014249 | ||||||
Transcript | ZK1307.8.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1307.8.1:c.101-38_589del | |||||||
cDNA_position | ?-591 | |||||||
CDS_position | ?-589 | |||||||
Protein_position | ?-197 | |||||||
Intron_number | 2/5 | |||||||
Exon_number | 3/6 | |||||||
ZK1307.8.3 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1307.8.3:c.101-38_589del | |||||||
cDNA_position | ?-615 | |||||||
CDS_position | ?-589 | |||||||
Protein_position | ?-197 | |||||||
Intron_number | 2/5 | |||||||
Exon_number | 3/6 | |||||||
ZK1307.8.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1307.8.2:c.101-38_589del | |||||||
cDNA_position | ?-591 | |||||||
CDS_position | ?-589 | |||||||
Protein_position | ?-197 | |||||||
Intron_number | 2/5 | |||||||
Exon_number | 3/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000648 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Barr to the National Bioresource Project of Japan: male mating behavior normal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Barr to the National Bioresource Project of Japan: brood size normal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001068 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Barr to the National Bioresource Project of Japan: 5-HT-induced egg laying normal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | [T15H9] 21923/21924-[ZK1307] 260/261 (528 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target T15H9 updated based on the VEP analysis pipeline to CHROMOSOME_II. | ||||||||
Method | NBP_knockout_allele |