WormBase Tree Display for Variation: WBVar00250495

WBVar00250495 Name: Public_name: tm1503
    Other_name: F08C6.4a.1:c.-56_196-21del
    HGVSg: CHROMOSOME_X:g.7562835_7563417del
  Sequence_details: SMap: S_parent: Sequence: F08C6
    Flanking_sequences: ttctgtgacggctcgcgtaggcggtcgcac aggatgtattttttcttcagattgttcagg
    Mapping_target: F08C6
    Source_location: 7 CHROMOSOME_X 7562834 7563418 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1503_external
      tm1503_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1503
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006063
    Transcript: F08C6.4a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F08C6.4a.1:c.-56_196-21del
        cDNA_position: 12-?
        Intron_number: 2-3/8
        Exon_number: 1-3/9
      F08C6.4b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-3/9
        Exon_number: 1-3/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from the National Bioresource Project of Japan: Dr. C. Hunter: normal growth Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: TV
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000315 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
          WBPerson557
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Chalfie: non-Mec. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
          Comment from the National Bioresource Project of Japan: Dr. M. Chalfie: non-Mec Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: TV
      WBPhenotype:0000518 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from the National Bioresource Project of Japan: Dr. C. Hunter: normal developement at 20C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: TV
      WBPhenotype:0000625 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson557
        Remark: Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal synapse formation as determined by VAMP::YFP localization to presynaptic sites in HSNL. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson557
            Laboratory_evidence: TV
      WBPhenotype:0002535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: Dyf+ in all sensory neurons. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: PY
  Remark: 4891/4892-5474/5475 (583 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele