WormBase Tree Display for Variation: WBVar00250490
expand all nodes | collapse all nodes | view schema
WBVar00250490 | Name | Public_name | tm1498 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T22D1.12a.1:c.570+82_845delinsG | |||||||
T22D1.12b.1:c.588+82_863delinsG | ||||||||
HGVSg | CHROMOSOME_IV:g.6929666_6930270delinsC | |||||||
Sequence_details | SMap | S_parent | Sequence | T22D1 | ||||
Flanking_sequences | taaatattcattggagcccaacacacggca | aaaaaataaaaaaggagtggaattttgaaa | ||||||
Mapping_target | T22D1 | |||||||
Source_location | 7 | CHROMOSOME_IV | 6929665 | 6930271 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | C | ||||||
Deletion | ||||||||
PCR_product | tm1498_external | |||||||
tm1498_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1498 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020689 | ||||||
Transcript | T22D1.12b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T22D1.12b.1:c.588+82_863delinsG | |||||||
cDNA_position | ?-863 | |||||||
CDS_position | ?-863 | |||||||
Protein_position | ?-288 | |||||||
Intron_number | 4/7 | |||||||
Exon_number | 5/8 | |||||||
T22D1.12a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T22D1.12a.1:c.570+82_845delinsG | |||||||
cDNA_position | ?-846 | |||||||
CDS_position | ?-845 | |||||||
Protein_position | ?-282 | |||||||
Intron_number | 4/8 | |||||||
Exon_number | 5/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000176 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to National Bioresournce Project of Japan from Dr. L. Avery: satiety behavior normal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000659 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to National Bioresournce Project of Japan from Dr. L. Avery: feeding behavior normal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00043908 | |||||||
WBPaper00066032 | ||||||||
Remark | 38843/38844-C-39448/39449 (605 bp deletion + 1 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |