WormBase Tree Display for Variation: WBVar00250490

WBVar00250490 Name: Public_name: tm1498
    Other_name: T22D1.12a.1:c.570+82_845delinsG
      T22D1.12b.1:c.588+82_863delinsG
    HGVSg: CHROMOSOME_IV:g.6929666_6930270delinsC
  Sequence_details: SMap: S_parent: Sequence: T22D1
    Flanking_sequences: taaatattcattggagcccaacacacggca aaaaaataaaaaaggagtggaattttgaaa
    Mapping_target: T22D1
    Source_location: 7 CHROMOSOME_IV 6929665 6930271 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: C
      Deletion
    PCR_product: tm1498_external
      tm1498_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1498
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00020689
    Transcript: T22D1.12b.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T22D1.12b.1:c.588+82_863delinsG
        cDNA_position: ?-863
        CDS_position: ?-863
        Protein_position: ?-288
        Intron_number: 4/7
        Exon_number: 5/8
      T22D1.12a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T22D1.12a.1:c.570+82_845delinsG
        cDNA_position: ?-846
        CDS_position: ?-845
        Protein_position: ?-282
        Intron_number: 4/8
        Exon_number: 5/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype (16)
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000176 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to National Bioresournce Project of Japan from Dr. L. Avery: satiety behavior normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000659 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to National Bioresournce Project of Japan from Dr. L. Avery: feeding behavior normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00043908
    WBPaper00066032
  Remark: 38843/38844-C-39448/39449 (605 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele