WormBase Tree Display for Variation: WBVar00250487

WBVar00250487 Name: Public_name: tm1495
    HGVSg: CHROMOSOME_X:g.11643972_11644425del
  Sequence_details: SMap: S_parent: Sequence: Y71H9A
    Flanking_sequences: cgctcgctcgctcacacacacacacacaca agtgtccaccttgagatatgcaacgtcaag
    Mapping_target: Y71H9A
    Source_location: 7 CHROMOSOME_X 11643971 11644426 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1495_external
      tm1495_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1495
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006066
    Transcript: Y71H9A.3.2 VEP_consequence: splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-153
        Intron_number: 1/11
        Exon_number: 1-2/12
      Y71H9A.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-161
        Intron_number: 1/11
        Exon_number: 1-2/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from the National Bioresource Project of Japan: Dr. C. Hunter: normal growth Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000315 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
          WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Chalfie: non-Mec. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
          Comment from the National Bioresource Project of Japan: Dr. M. Chalfie: non-Mec Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000518 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from the National Bioresource Project of Japan: Dr. C. Hunter: normal developement at 20C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 20128/20129-20582/20583 (454 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele