WormBase Tree Display for Variation: WBVar00250469

WBVar00250469 Name: Public_name: tm1477
    HGVSg: CHROMOSOME_X:g.9850337_9851502del
  Sequence_details: SMap: S_parent: Sequence: R07B1
    Flanking_sequences: agatcgatgttaaaattccttgaaatacca acaatgcccattctggctgaaaattcacat
    Mapping_target: R07B1
    Source_location: 7 CHROMOSOME_X 9850336 9851503 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1477_external
      tm1477_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1477
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002271
    Transcript: R07B1.10.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 2-3/4
        Exon_number: 1-5/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0001379 Paper_evidence: WBPaper00034766
        Curator_confirmed: WBPerson712
        Remark: At low concentrations of t-Cry5B, the percentage of dead or visibly ill N2 worms was almost negligible, whereas the lec-8(tm1477) mutants were more vulnerable Paper_evidence: WBPaper00034766
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00034766
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0002535 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Leroux to the National Bioresource Project of Japan: Dyf normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00034766
  Remark: 9538/9539-10704/10705 (1166 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele