WormBase Tree Display for Variation: WBVar00250443

WBVar00250443 Name: Public_name: tm1450
    HGVSg: CHROMOSOME_IV:g.11520939_11521302del
  Sequence_details: SMap: S_parent: Sequence: M04B2
    Flanking_sequences: ccaggctcaaaatgtcgttcgttctcaaat gacagaaattgtggagcgtatgaaaaagaa
    Mapping_target: M04B2
    Source_location: 7 CHROMOSOME_IV 11520938 11521303 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1450_external
      tm1450_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1450
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001585
      WBGene00010847
    Transcript: M04B2.4.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-93
        CDS_position: ?-92
        Protein_position: ?-31
        Exon_number: 1-2/11
      M04B2.3.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-13
        CDS_position: ?-2
        Protein_position: ?-1
        Exon_number: 1-2/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
    Mapping_data: In_multi_point: 4832
        4863
  Description: Phenotype: WBPhenotype:0000057 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: early larval lethal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000775 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comment from Dr. A. Dernburg to the National Bioresource Project of Japan: no obvious role in meiosis. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Remark: 16005/16006-16369/16370 (364 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele