WormBase Tree Display for Variation: WBVar00250415
expand all nodes | collapse all nodes | view schema
WBVar00250415 | Name | Public_name | tm1422 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | B0410.2b.1:c.194_633+45del | ||||||||
B0410.2a.1:c.194_642+45del | |||||||||
HGVSg | CHROMOSOME_X:g.2886877_2887472del | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0410 | |||||
Flanking_sequences | agattgcaccacctaacgaagactgggcag | tttttgggatttttttgctggcttttttta | |||||||
Mapping_target | B0410 | ||||||||
Source_location | 7 | CHROMOSOME_X | 2886876 | 2887473 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm1422_external | ||||||||
tm1422_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1422 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015171 | |||||||
Transcript | B0410.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0410.2b.1:c.194_633+45del | ||||||||
cDNA_position | 194-? | ||||||||
CDS_position | 194-? | ||||||||
Protein_position | 65-? | ||||||||
Intron_number | 2-4/7 | ||||||||
Exon_number | 2-4/8 | ||||||||
B0410.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0410.2a.1:c.194_642+45del | ||||||||
cDNA_position | 208-? | ||||||||
CDS_position | 194-? | ||||||||
Protein_position | 65-? | ||||||||
Intron_number | 3-5/9 | ||||||||
Exon_number | 3-5/10 | ||||||||
Interactor | WBInteraction000505056 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Mapping_data | In_multi_point | 5098 | |||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00040810 | |||||
Curator_confirmed | WBPerson12968 | ||||||||
WBPhenotype:0001384 | Paper_evidence | WBPaper00040810 | |||||||
Curator_confirmed | WBPerson12968 | ||||||||
WBPhenotype:0001663 | Paper_evidence | WBPaper00040810 | |||||||
Curator_confirmed | WBPerson12968 | ||||||||
WBPhenotype:0002490 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. A. Colavita: ectopic VC axons. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | OU | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005304 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00040810 | ||||||
Curator_confirmed | WBPerson12968 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000469 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. G. Garriga: no obvious HSN or Q neuroblast migration defects. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | NG | ||||||||
WBPhenotype:0000470 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. G. Garriga: no obvious HSN or Q neuroblast migration defects. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | NG | ||||||||
WBPhenotype:0000729 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. C. Yang: normal cell death phenotype. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FU | ||||||||
WBPhenotype:0001225 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. H. Sawa: no Psa phenotype. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | HS | ||||||||
Reference | WBPaper00040810 | ||||||||
Remark | 1420/1421-2016/2017 (596 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |