WormBase Tree Display for Variation: WBVar00250403
expand all nodes | collapse all nodes | view schema
WBVar00250403 | Name | Public_name | tm1410 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE28488:p.His62LeufsTer9 | |||||||
T23F2.1b.1:c.227_765delinsTTT | ||||||||
T23F2.1a.1:c.185_723delinsTTT | ||||||||
CE54583:p.His76LeufsTer9 | ||||||||
HGVSg | CHROMOSOME_X:g.5493996_5494701delinsTTT | |||||||
Sequence_details | SMap | S_parent | Sequence | T23F2 | ||||
Flanking_sequences | cagaaattcgagaggttgggctcaagcttc | atgccacacattccggaaagtagaatatat | ||||||
Mapping_target | T23F2 | |||||||
Source_location | 7 | CHROMOSOME_X | 5493995 | 5494702 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | TTT | ||||||
Deletion | ||||||||
PCR_product | tm1410_external | |||||||
tm1410_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004737 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1410 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00044623 | ||||||
Transcript | T23F2.1b.1 (11) | |||||||
T23F2.1a.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 100% embryonic lethal. 55% of the embryos arrested with an enlarged, deep and persistent gastrulation cleft, ventral enclosure was not completed; 12% of the embryos arrested with completed ventral enclosure at the posterior of the embryo, but not at the anterior; the remaining 33% of the embryos arrested after an apparently normal ventral enclosure but experience slow leakage of cells from the anterior tip of the animal. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | jcIs1 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001566 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 100% embryonic lethal. 55% of the embryos arrested with an enlarged, deep and persistent gastrulation cleft, ventral enclosure was not completed; 12% of the embryos arrested with completed ventral enclosure at the posterior of the embryo, but not at the anterior; the remaining 33% of the embryos arrested after an apparently normal ventral enclosure but experience slow leakage of cells from the anterior tip of the animal. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | jcIs1 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031667 | |||||||
Remark | 1727/1728-TTT-2433/2434 (706 bp deletion + 3 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |