WormBase Tree Display for Variation: WBVar00250368

WBVar00250368 Name: Public_name: tm1374
    Other_name: R06C1.1.1:c.522_634+311del
    HGVSg: CHROMOSOME_I:g.11915531_11915954del
  Sequence_details: SMap: S_parent: Sequence: R06C1
    Flanking_sequences: cggaaattttctattcagacaatttgccga atatcaatataaagaactcttttatgatgc
    Mapping_target: R06C1
    Source_location: 7 CHROMOSOME_I 11915530 11915955 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1374_external
      tm1374_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1374
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001836
    Transcript: R06C1.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R06C1.1.1:c.522_634+311del
        cDNA_position: 522-?
        CDS_position: 522-?
        Protein_position: 174-?
        Intron_number: 2/5
        Exon_number: 2/6
    Interactor: WBInteraction000052351
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. W.G. Kelly: slight Egl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001384 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. W.G. Kelly: exhibit a slight decrease in fertility Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. W.G. Kelly: viable. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 2082/2083-2506/2507 (424 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele