WormBase Tree Display for Variation: WBVar00250293

WBVar00250293 Name: Public_name: tm1287
    Other_name: Y48A5A.2.1:c.261+120_327del
    HGVSg: CHROMOSOME_IV:g.1964044_1964403del
  Sequence_details: SMap: S_parent: Sequence: Y48A5A
    Flanking_sequences: aattccattatttttttttgtttttcgatg ttgattttcgaccgaaaaatcgataaattc
    Mapping_target: Y48A5A
    Source_location: 7 CHROMOSOME_IV 1964043 1964404 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1287_external
      tm1287_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1287
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006738
    Transcript: Y48A5A.2.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y48A5A.2.1:c.261+120_327del
        cDNA_position: ?-357
        CDS_position: ?-327
        Protein_position: ?-109
        Intron_number: 2/3
        Exon_number: 3/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0001896 Paper_evidence: WBPaper00058667
        Curator_confirmed: WBPerson6456
    Phenotype_not_observed: WBPhenotype:0000032 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Inoue to the National Bioresource Project of Japan: healthy. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000054 Paper_evidence: WBPaper00058667
        Curator_confirmed: WBPerson6456
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000315 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Inoue to the National Bioresource Project of Japan: normal response to touch and tap stimuli. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Inoue to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000676 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Inoue to the National Bioresource Project of Japan: normal growth rate. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Inoue to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00058667
  Remark: 3595/3596-3955/3956 (360 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele