WormBase Tree Display for Variation: WBVar00250167

WBVar00250167 Name: Public_name: tm1151
    HGVSg: CHROMOSOME_II:g.14818373_14818983delinsTTCCGAGA
  Sequence_details: SMap: S_parent: Sequence: W01D2
    Flanking_sequences: cgttcactccgtagtgttttccgagagcct gcccaagaaggtctagaaaagtctaggagc
    Mapping_target: W01D2
    Source_location: 7 CHROMOSOME_II 14818372 14818984 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTCCGAGA
      Deletion
    PCR_product: tm1151_external
      tm1151_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1151
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003651
    Transcript: W01D2.2b.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/7
        Exon_number: 1-2/8
      W01D2.2a.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/7
        Exon_number: 1-2/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: normal body morphology Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000195 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. J. Hubbard: normal DTC migration. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000823 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. J. Hubbard: normal germline proliferation and normal DTC migration. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001355 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: normal gonad morphology Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 17765/17766-TTCCGAGA-18376/18377 (611 bp deletion + 8 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele