WormBase Tree Display for Variation: WBVar00250150
expand all nodes | collapse all nodes | view schema
WBVar00250150 | Name | Public_name | tm1133 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE02898:p.Glu62_Ile167delinsGlnCysGlyTer | ||||||||
ZK1248.14.1:c.184_500delinsCAATGTGGCTGAAC | |||||||||
HGVSg | CHROMOSOME_II:g.5835553_5835971delinsGTTCAGCCACATTG | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1248 | |||||
Flanking_sequences | tctgaattttcgtcactcagtgcgtgtcca | tagttcagccacattgtctttcagttctcc | |||||||
Mapping_target | ZK1248 | ||||||||
Source_location | 7 | CHROMOSOME_II | 5835552 | 5835972 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | GTTCAGCCACATTG | |||||||
Deletion | |||||||||
PCR_product | tm1133_external | ||||||||
tm1133_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005194 | ||||||||
WBStrain00056745 | |||||||||
Component_of_genotype | WBGenotype00000133 | ||||||||
WBGenotype00000135 | |||||||||
Laboratory | FX | ||||||||
EN | |||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1133 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001509 | |||||||
Transcript | ZK1248.14.1 (11) | ||||||||
Interactor | WBInteraction000571765 | ||||||||
WBInteraction000571767 | |||||||||
WBInteraction000571768 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | II | |||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. J-C. Martinou to the National Bioresource Project of : a bit slow growth at 20 degree. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | JCM | ||||||||
Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000059 | Paper_evidence | WBPaper00062487 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | Transient phenotype, depends on the mitochondrial DNA deletion copy numbers. | Paper_evidence | WBPaper00062487 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
WBPhenotype:0000120 | Paper_evidence | WBPaper00035144 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The level of bc1 protein (a protein of complex III of the electron transport chain) is reduced in fzo-1(tm1133) animals | Paper_evidence | WBPaper00035144 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000140 | Paper_evidence | WBPaper00041209 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | exacerbated L3 arrest compared with wild-type at 72 and 96 h | Paper_evidence | WBPaper00041209 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003513 | Paper_evidence | WBPaper00041209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00041209 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | serial ultraviolet C radiation(UVC) exposure (10 J/m2) | Paper_evidence | WBPaper00041209 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00062487 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | Aggravated phenotype depends on the mitochondrial DNA deletion copy numbers. | Paper_evidence | WBPaper00062487 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00056369 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
WBPhenotype:0001282 | Paper_evidence | WBPaper00035144 | |||||||
WBPaper00047030 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson25433 | |||||||||
Remark | fzo-1(tm1133) animals seem to have less active mitochondria when stained with TMRE | Paper_evidence | WBPaper00035144 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reduced maximal respiratory capacity, spare respiratory capacity, and proton leak in L4 stage nematodes | Paper_evidence | WBPaper00047030 | |||||||
Curator_confirmed | WBPerson25433 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00047030 | ||||
Curator_confirmed | WBPerson25433 | ||||||||
GO_term | GO:0009060 | PATO:0000460 | Paper_evidence | WBPaper00047030 | |||||
Curator_confirmed | WBPerson25433 | ||||||||
GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00047030 | ||||||
Curator_confirmed | WBPerson25433 | ||||||||
WBPhenotype:0001401 | Paper_evidence | WBPaper00047030 | |||||||
WBPaper00059575 | |||||||||
Curator_confirmed | WBPerson25433 | ||||||||
WBPerson557 | |||||||||
Remark | Fragmented mitochondria in L4 stage nematodes | Paper_evidence | WBPaper00047030 | ||||||
Curator_confirmed | WBPerson25433 | ||||||||
fzo-1(tm1133) animals have small spherical mitochondria. | Paper_evidence | WBPaper00059575 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00047030 | ||||
Curator_confirmed | WBPerson25433 | ||||||||
GO_term | GO:0005739 | PATO:0001444 | Paper_evidence | WBPaper00047030 | |||||
Curator_confirmed | WBPerson25433 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00059575 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001805 | Paper_evidence | WBPaper00032231 | |||||||
WBPaper00033026 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mitochondria were vesiculated. | Paper_evidence | WBPaper00032231 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
fzo-1(tm1133) embryos displayed only small and spherical mitochondria, with a mean mitochondrial length of 0.38 um | Paper_evidence | WBPaper00033026 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032231 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00032231 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002430 | Paper_evidence | WBPaper00062487 | |||||||
Curator_confirmed | WBPerson5063 | ||||||||
Remark | Selection against mitochondrial DNA harboring deletions including uaDf5, bguDf1, bguDf2. | Paper_evidence | WBPaper00062487 | ||||||
Curator_confirmed | WBPerson5063 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comments to the NBP from Dr. Xue: Mol Cell 31, 586 (2008). Dr. T. Oka: J. Biochem. 143, 449 (2008). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
CU | |||||||||
WBPhenotype:0000746 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the National Bioresource Project of Japan: Dr. H. Sawa: normal embryonic cell division. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | HS | ||||||||
WBPhenotype:0001380 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. J-C. Martinou to the National Bioresource Project of : not hypersensitive to anoxia. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | JCM | ||||||||
Reference (11) | |||||||||
Remark | 26031/26032-GTTCAGCCACATTG-26450/26451 (419 bp deletion + 14 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |