WormBase Tree Display for Variation: WBVar00250129

WBVar00250129 Name: Public_name: tm1112
    HGVSg: CHROMOSOME_I:g.9689399_9690763del
  Sequence_details: SMap: S_parent: Sequence: C04F12
    Flanking_sequences: tttttaaaacgtttagattatcaatgcgat tttgtccatttttgaaggacggatgagtgt
    Mapping_target: C04F12
    Source_location: 7 CHROMOSOME_I 9689398 9690764 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1112_external
      tm1112_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1112
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007299
      WBGene00004426
    Transcript: C04F12.5.2 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 1/2
        Exon_number: 1-3/3
      C04F12.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-3/4
        Exon_number: 3-5/5
      C04F12.5.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 1/2
        Exon_number: 1-3/3
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 17163/17164-18528/18529 (1365 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele