WormBase Tree Display for Variation: WBVar00249802

WBVar00249802 Name: Public_name: tm774
    Other_name (25)
    HGVSg: CHROMOSOME_V:g.23999_24591del
  Sequence_details: SMap: S_parent: Sequence: B0348
    Flanking_sequences: atgtatttttcaaaaaaaaattgccttaac aaaaagaagaaaaccggttgaaaacgataa
    Mapping_target: B0348
    Source_location: 7 CHROMOSOME_V 23998 24592 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm774_external
      tm774_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 774
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001177
    Transcript (25)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 18969/18970-19562/19563 (593 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele