WormBase Tree Display for Variation: WBVar00249759

WBVar00249759 Name: Public_name: tm729
    Other_name: K04B12.1.1:c.151-36_1376del
    HGVSg: CHROMOSOME_II:g.14422974_14424633del
  Sequence_details: SMap: S_parent: Sequence: K04B12
    Flanking_sequences: ggatgacaccattggcagagtgggtctaca cttctgcttaggcttattaggcaggcagaa
    Mapping_target: K04B12
    Source_location: 7 CHROMOSOME_II 14422973 14424634 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm729_external
      tm729_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 729
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004048
    Transcript: K04B12.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K04B12.1.1:c.151-36_1376del
        cDNA_position: ?-1386
        CDS_position: ?-1376
        Protein_position: ?-459
        Intron_number: 2-7/16
        Exon_number: 3-8/17
    Interactor: WBInteraction000052044
      WBInteraction000052045
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. S. Takagi: apparently normal, enhancer of weak alleles of mab-20 (bx61 and bx24). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000102 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal DA presynaptic puncta. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000886 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. Takagi to the National Bioresource Project of Japan: apparently normal, enhancer of weak alleles of mab-20 (bx61 & bx24). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 7631/7632-9291/9292 (1660 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele