WormBase Tree Display for Variation: WBVar00249756

WBVar00249756 Name: Public_name: tm726
    Other_name: C02B8.4.2:c.103-648_103-3del
      C02B8.4.1:c.103-648_103-3del
    HGVSg: CHROMOSOME_X:g.8118111_8118756del
  Sequence_details: SMap: S_parent: Sequence: C02B8
    Flanking_sequences: tctgaatcctgagaacatctggagacaatt aggaactcaatgacgctttcacacttttgc
    Mapping_target: C02B8
    Source_location: 7 CHROMOSOME_X 8118110 8118757 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm726_external
      tm726_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 726
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001953
    Transcript: C02B8.4.2 VEP_consequence: splice_region_variant,intron_variant
        VEP_impact: LOW
        HGVSc: C02B8.4.2:c.103-648_103-3del
        Intron_number: 2/6
      C02B8.4.1 VEP_consequence: splice_region_variant,intron_variant
        VEP_impact: LOW
        HGVSc: C02B8.4.1:c.103-648_103-3del
        Intron_number: 2/6
    Interactor: WBInteraction000520220
      WBInteraction000520221
      WBInteraction000520222
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000006 Paper_evidence: WBPaper00036744
        Curator_confirmed: WBPerson712
        Remark: Animals are partially egg-laying defective. Paper_evidence: WBPaper00036744
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00036744
              Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000095 Paper_evidence: WBPaper00036744
        Curator_confirmed: WBPerson712
        Remark: Animals differed significantly from wild type animals in the number of correct dorsal/ventral divisions of the first M cell division and the number of divisions of SMs. However the defect was less severe than the null allele nr2061. Further, animals still maintained a wild type number of coelomocytes. Paper_evidence: WBPaper00036744
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00036744
              Curator_confirmed: WBPerson712
      WBPhenotype:0000114 Paper_evidence: WBPaper00036744
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited an overall decrease in the levels of hlh-8 mRNA and four alternative splice products due to splicing defects. Paper_evidence: WBPaper00036744
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00036744
              Curator_confirmed: WBPerson712
      WBPhenotype:0000134 Paper_evidence: WBPaper00036744
        Curator_confirmed: WBPerson712
        Remark: CeTwist target genes arg-1::gfp and NdEbox::gfp (ceh-24) were not expressed, while egl-15::gfp was expressed in the vms in only 15% of the animals; however, the gfp prematurely turned off in 74% of those animals. Animals were not as severe as hlh-8() animals, in that they were able to partially activate one of the CeTwist downstream targets. Paper_evidence: WBPaper00036744
            Curator_confirmed: WBPerson712
      WBPhenotype:0000154 Paper_evidence: WBPaper00036744
        Curator_confirmed: WBPerson712
      WBPhenotype:0000651 Paper_evidence: WBPaper00036744
        Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000695 Paper_evidence: WBPaper00036744
        Curator_confirmed: WBPerson712
        Remark: Close to three quarters of the animals developed either a Pvl or everted vulva phenotype within five days of adulthood. Paper_evidence: WBPaper00036744
            Curator_confirmed: WBPerson712
  Reference: WBPaper00036744
  Remark: 5378/5379-6024/6025 (646 deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele