WormBase Tree Display for Variation: WBVar00249755
expand all nodes | collapse all nodes | view schema
WBVar00249755 | Name | Public_name | tm725 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE50552:p.Ile149LysfsTer4 | ||||||||
CE42665:p.Ile149LysfsTer4 | |||||||||
Y116A8C.36d.1:c.446_810del | |||||||||
Y116A8C.36a.1:c.446_810del | |||||||||
HGVSg | CHROMOSOME_IV:g.17120180_17121027del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y116A8C | |||||
Flanking_sequences | ccggaactccatctagcagacacaactcga | aatacccctgaactcgaaccaggagcggag | |||||||
Mapping_target | Y116A8C | ||||||||
Source_location | 7 | CHROMOSOME_IV | 17120179 | 17121028 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm725_external | ||||||||
tm725_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 725 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006405 | |||||||
Transcript | Y116A8C.36b.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-30 | ||||||||
CDS_position | ?-30 | ||||||||
Protein_position | ?-10 | ||||||||
Exon_number | 1/6 | ||||||||
Y116A8C.36a.1 (11) | |||||||||
Y116A8C.36e.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-30 | ||||||||
CDS_position | ?-30 | ||||||||
Protein_position | ?-10 | ||||||||
Exon_number | 1/6 | ||||||||
Y116A8C.36d.1 (11) | |||||||||
Interactor | WBInteraction000538784 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | IV | |||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031112 | |||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | itsn-1(ok268) and itsn-1(tm725) worms were hypersensitive to aldicarb, in acute and chronic assays | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Comment from Dr. A. Salcini: aldicarb hypersensitive. | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | ZR | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031112 | |||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031112 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00031546 | |||||||
Curator_confirmed | WBPerson7761 | ||||||||
Remark | Null mutants are viable and display grossly normal locomotion and development. However, motor neurons in these mutants show a dramatic increase in large irregular vesicles and accumulate membrane-associated vesicles at putative endocytic hotspots, approximately 300 nm from the presynaptic density. | Paper_evidence | WBPaper00031546 | ||||||
Curator_confirmed | WBPerson7761 | ||||||||
WBPhenotype:0001323 | Paper_evidence | WBPaper00031546 | |||||||
Curator_confirmed | WBPerson7761 | ||||||||
Remark | Null mutants are viable and display grossly normal locomotion and development. However, motor neurons in these mutants show a dramatic increase in large irregular vesicles and accumulate membrane-associated vesicles at putative endocytic hotspots, approximately 300 nm from the presynaptic density. | Paper_evidence | WBPaper00031546 | ||||||
Curator_confirmed | WBPerson7761 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005409 | PATO:0000460 | Paper_evidence | WBPaper00031546 | ||||
Curator_confirmed | WBPerson7761 | ||||||||
WBPhenotype:0001671 | Paper_evidence | WBPaper00031546 | |||||||
Curator_confirmed | WBPerson7761 | ||||||||
Remark | Null mutants are viable and display grossly normal locomotion and development. However, motor neurons in these mutants show a dramatic increase in large irregular vesicles and accumulate membrane-associated vesicles at putative endocytic hotspots, approximately 300 nm from the presynaptic density. | Paper_evidence | WBPaper00031546 | ||||||
Curator_confirmed | WBPerson7761 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005409 | PATO:0000460 | Paper_evidence | WBPaper00031546 | ||||
Curator_confirmed | WBPerson7761 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00031112 | ||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
itsn-1 mutants were viable | Paper_evidence | WBPaper00031112 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C-25C | Paper_evidence | WBPaper00031112 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000207 | Paper_evidence | WBPaper00031112 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Behavioral tests, including pumping, defecation cycle, and locomotion, were unaltered, both at 15 and 25C | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C-25C | Paper_evidence | WBPaper00031112 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000518 | Paper_evidence | WBPaper00031546 | |||||||
Curator_confirmed | WBPerson7761 | ||||||||
Remark | Null mutants are viable and display grossly normal locomotion and development. | Paper_evidence | WBPaper00031546 | ||||||
Curator_confirmed | WBPerson7761 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00031112 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The itsn-1 mutants did not display any obvious morphological phenotype | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C-25C | Paper_evidence | WBPaper00031112 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00031112 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Behavioral tests, including pumping, defecation cycle, and locomotion, were unaltered, both at 15 and 25C | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C-25C | Paper_evidence | WBPaper00031112 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00031112 | |||||||
WBPaper00031546 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson7761 | |||||||||
Remark | Behavioral tests, including pumping, defecation cycle, and locomotion, were unaltered, both at 15 and 25C | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Null mutants are viable and display grossly normal locomotion and development. | Paper_evidence | WBPaper00031546 | |||||||
Curator_confirmed | WBPerson7761 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C-25C | Paper_evidence | WBPaper00031112 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00031112 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | itsn-1 mutants are fertile | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 15C-25C | Paper_evidence | WBPaper00031112 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00031112 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | itsn-1(ok268) and itsn-1(tm725) displayed wild-type behavior in response to levamisole | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031112 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031112 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031112 | ||||||||
WBPaper00031546 | |||||||||
Remark | 220089/220090-220937/220938 (848 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |