WormBase Tree Display for Variation: WBVar00249736
expand all nodes | collapse all nodes | view schema
WBVar00249736 | Name | Public_name | tm706 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | ZK337.2.1:c.465-115_792+11del | |||||||
HGVSg | CHROMOSOME_I:g.14978675_14979177del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK337 | ||||
Flanking_sequences | gctgccaagatttgagattttagctaaaaa | cacctacatctcaacattgtctatatttca | ||||||
Mapping_target | ZK337 | |||||||
Source_location | 7 | CHROMOSOME_I | 14978674 | 14979178 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm706_external | |||||||
tm706_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 706 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00013970 | ||||||
Transcript | ZK337.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK337.2.1:c.465-115_792+11del | |||||||
Intron_number | 4-6/10 | |||||||
Exon_number | 5-6/11 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P. Okkema to the National Bioresource Project of Japan: wild-type growth. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000886 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P. Okkema to the National Bioresource Project of Japan: no defects. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 5308/5309-5811/5812 (503 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |