WormBase Tree Display for Variation: WBVar00249472
expand all nodes | collapse all nodes | view schema
WBVar00249472 | Name | Public_name | tm424 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | E03A3.2.1:c.1165-50_1488-127del | |||||||
HGVSg | CHROMOSOME_III:g.4055238_4055834del | |||||||
Sequence_details | SMap | S_parent | Sequence | E03A3 | ||||
Flanking_sequences | tgggtctcggcgcacaataaaaaaatggct | aggtctcgacacgcaagtttttgttaaatg | ||||||
Mapping_target | E03A3 | |||||||
Source_location | 7 | CHROMOSOME_III | 4055237 | 4055835 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm424_external | |||||||
tm424_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 424 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004322 | ||||||
Transcript | E03A3.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | E03A3.2.1:c.1165-50_1488-127del | |||||||
Intron_number | 4-5/11 | |||||||
Exon_number | 5/12 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Mapping_data | In_multi_point | 4627 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000711 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comment from Dr. S. Ahmed to the National Bioresource Project of Japan: Not hypersensitive to ionizing radiation. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | 12982/12983-13579/13580 (597 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |