WormBase Tree Display for Variation: WBVar00249436
expand all nodes | collapse all nodes | view schema
WBVar00249436 | Name | Public_name | tm388 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | B0414.2.1:c.307+18_381+200del | ||||||||
B0414.2.2:c.307+18_381+200del | |||||||||
B0414.2.3:c.307+18_381+200del | |||||||||
HGVSg | CHROMOSOME_I:g.5785318_5786375del | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0414 | |||||
Flanking_sequences | cggtccggcagaggtgagtactgtagccaa | tgtgctatttttgaggcaaaatagattttt | |||||||
Mapping_target | B0414 | ||||||||
Source_location | 7 | CHROMOSOME_I | 5785317 | 5786376 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm388_external | ||||||||
tm388_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 388 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004393 | |||||||
Transcript | B0414.2.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0414.2.3:c.307+18_381+200del | ||||||||
Intron_number | 7-8/12 | ||||||||
Exon_number | 8/13 | ||||||||
B0414.2.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0414.2.2:c.307+18_381+200del | ||||||||
Intron_number | 7-8/12 | ||||||||
Exon_number | 8/13 | ||||||||
B0414.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0414.2.1:c.307+18_381+200del | ||||||||
Intron_number | 4-5/9 | ||||||||
Exon_number | 5/10 | ||||||||
Interactor | WBInteraction000502237 | ||||||||
WBInteraction000502238 | |||||||||
WBInteraction000524653 | |||||||||
WBInteraction000538733 | |||||||||
WBInteraction000538734 | |||||||||
WBInteraction000538735 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "rnt-1(tm388) has a deletion spanning from intron 3 to intron 4, resulting in a frame shift and a premature stop codon in the Runt domain (Fig. 1). Molecular data indicate rnt-1(tm388) is a null mutation. The tm388 transcript lacks the C-terminal half of the RNT-1 coding sequences, including residues critical for DNA recognition in the Runt domain. rnt-1(tm388) homozygous animals were viable and showed no gross morphological defects in hermaphrodites. However, the rnt-1(tm388) males showed striking phenotypes in which many copulatory rays in the tail were lost and the overall structure of the male tail was often destroyed (Fig. 2). rnt-1(tm388) males failed to mate with hermaphrodites (Table 1)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000324 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comment from Dr. J. Lee: short body length. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000828 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The defect of rnt-1 mutants in asymmetrical division was also ascertained by a direct cell lineage analysis. In eight out of the eleven T lineages examined in the rnt-1(tm388) animals, the T cell divided symmetrically, giving rise solely to hypodermal cells from both T.a and T.p (Figs. 4B, C). All these data demonstrated that mutations in rnt-1 result in the loss of asymmetry in the T cells and T.p sublineage." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 72 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In wild-type, the level of GFP::POP-1 was higher in T.a (T.a > T.p) in 100% of the wild-type T cell lineages examined (Figs. 5A, E). In rnt-1, most of the T cell lineages (91%) exhibited a higher level of GFP::POP-1 in T.a (T.a > T.p), and the rest of the lineages (9%) showed the same level of expression in T.a and T.p (T.a = T.p) (Figs. 5B, E)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In the present study, we also confirmed that the level of TLP-1::GFP was higher in T.p (T.a < T.p) in 76% of wild-type animals. In rnt-1(tm388), however, the expression level of TLP-1::GFP is significantly reduced and the proportion showing a normal, asymmetrical expression of TLP-1::GFP (T.a < T.p) was decreased to 20% (Figs. 5D, E)." | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 9 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | GFP::POP-1 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
TLP-1::GFP | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001225 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We first examined the Psa phenotype in the T cells of hermaphrodites of all the rnt-1 alleles. A large proportion (51%-77%) of the mutants exhibited the Psa phenotype (Table 2)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 77 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Psa phenotype (see Materials and methods) was scored during the L2 stage." | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "rnt-1(tm388) has a deletion spanning from intron 3 to intron 4, resulting in a frame shift and a premature stop codon in the Runt domain (Fig. 1). Molecular data indicate rnt-1(tm388) is a null mutation. The tm388 transcript lacks the C-terminal half of the RNT-1 coding sequences, including residues critical for DNA recognition in the Runt domain. rnt-1(tm388) homozygous animals were viable and showed no gross morphological defects in hermaphrodites. However, the rnt-1(tm388) males showed striking phenotypes in which many copulatory rays in the tail were lost and the overall structure of the male tail was often destroyed (Fig. 2). rnt-1(tm388) males failed to mate with hermaphrodites (Table 1)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | him-8(e1489) | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001509 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "rnt-1(tm388) has a deletion spanning from intron 3 to intron 4, resulting in a frame shift and a premature stop codon in the Runt domain (Fig. 1). Molecular data indicate rnt-1(tm388) is a null mutation. The tm388 transcript lacks the C-terminal half of the RNT-1 coding sequences, including residues critical for DNA recognition in the Runt domain. rnt-1(tm388) homozygous animals were viable and showed no gross morphological defects in hermaphrodites. However, the rnt-1(tm388) males showed striking phenotypes in which many copulatory rays in the tail were lost and the overall structure of the male tail was often destroyed (Fig. 2). rnt-1(tm388) males failed to mate with hermaphrodites (Table 1)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001585 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The defect of rnt-1 mutants in asymmetrical division was also ascertained by a direct cell lineage analysis. In eight out of the eleven T lineages examined in the rnt-1(tm388) animals, the T cell divided symmetrically, giving rise solely to hypodermal cells from both T.a and T.p (Figs. 4B, C). All these data demonstrated that mutations in rnt-1 result in the loss of asymmetry in the T cells and T.p sublineage." (Table 3) | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In wild-type, the level of GFP::POP-1 was higher in T.a (T.a > T.p) in 100% of the wild-type T cell lineages examined (Figs. 5A, E). In rnt-1, most of the T cell lineages (91%) exhibited a higher level of GFP::POP-1 in T.a (T.a > T.p), and the rest of the lineages (9%) showed the same level of expression in T.a and T.p (T.a = T.p) (Figs. 5B, E)." | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In the present study, we also confirmed that the level of TLP-1::GFP was higher in T.p (T.a < T.p) in 76% of wild-type animals. In rnt-1(tm388), however, the expression level of TLP-1::GFP is significantly reduced and the proportion showing a normal, asymmetrical expression of TLP-1::GFP (T.a < T.p) was decreased to 20% (Figs. 5D, E)." | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 72 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Low | 9 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | GFP::POP-1 | Paper_evidence | WBPaper00026860 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
TLP-1::GFP | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002211 | Paper_evidence | WBPaper00035069 | |||||||
WBPaper00026860 | |||||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPerson2987 | |||||||||
Remark | "We next performed phasmid dye-filling analysis on hermaphrodites from all the alleles. Again, a large proportion (46%-73%) of the mutants displayed the Dyf phenotype (Table 2)." | Paper_evidence | WBPaper00026860 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00035069 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
61 | Paper_evidence | WBPaper00026860 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005425 | PATO:0000460 | Paper_evidence | WBPaper00026860 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00035069 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002535 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comment from Dr. M. Herman: phasmid Dyf. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
Phenotype_not_observed (4) | |||||||||
Reference (2) | |||||||||
Remark | 13728/13729-14786/14787 (1058 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |