WormBase Tree Display for Variation: WBVar00249436

WBVar00249436 Name: Public_name: tm388
    Other_name: B0414.2.1:c.307+18_381+200del
      B0414.2.2:c.307+18_381+200del
      B0414.2.3:c.307+18_381+200del
    HGVSg: CHROMOSOME_I:g.5785318_5786375del
  Sequence_details: SMap: S_parent: Sequence: B0414
    Flanking_sequences: cggtccggcagaggtgagtactgtagccaa tgtgctatttttgaggcaaaatagattttt
    Mapping_target: B0414
    Source_location: 7 CHROMOSOME_I 5785317 5786376 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm388_external
      tm388_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 388
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004393
    Transcript: B0414.2.3 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: B0414.2.3:c.307+18_381+200del
        Intron_number: 7-8/12
        Exon_number: 8/13
      B0414.2.2 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: B0414.2.2:c.307+18_381+200del
        Intron_number: 7-8/12
        Exon_number: 8/13
      B0414.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: B0414.2.1:c.307+18_381+200del
        Intron_number: 4-5/9
        Exon_number: 5/10
    Interactor: WBInteraction000502237
      WBInteraction000502238
      WBInteraction000524653
      WBInteraction000538733
      WBInteraction000538734
      WBInteraction000538735
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype (10)
    Phenotype_not_observed: WBPhenotype:0000062 Paper_evidence: WBPaper00026860
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
          WBPerson2987
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
          "rnt-1(tm388) has a deletion spanning from intron 3 to intron 4, resulting in a frame shift and a premature stop codon in the Runt domain (Fig. 1). Molecular data indicate rnt-1(tm388) is a null mutation. The tm388 transcript lacks the C-terminal half of the RNT-1 coding sequences, including residues critical for DNA recognition in the Runt domain. rnt-1(tm388) homozygous animals were viable and showed no gross morphological defects in hermaphrodites. However, the rnt-1(tm388) males showed striking phenotypes in which many copulatory rays in the tail were lost and the overall structure of the male tail was often destroyed (Fig. 2). rnt-1(tm388) males failed to mate with hermaphrodites (Table 1)." Paper_evidence: WBPaper00026860
            Curator_confirmed: WBPerson2987
        Variation_effect: Predicted_null_via_sequence: Paper_evidence: WBPaper00026860
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000155 Paper_evidence: WBPaper00026860
        Curator_confirmed: WBPerson2987
        Remark: Table 3 Paper_evidence: WBPaper00026860
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0004946 PATO:0000460 Paper_evidence: WBPaper00026860
                Curator_confirmed: WBPerson2987
            WBbt:0004944 PATO:0000460 Paper_evidence: WBPaper00026860
                Curator_confirmed: WBPerson2987
      WBPhenotype:0000529 Paper_evidence: WBPaper00026860
        Curator_confirmed: WBPerson2987
        Remark: "In rnt-1 mutants, although the T cells fail to divide asymmetrically, their seam-lineage descendants appear to keep features of the seam cells; (1) they express the seam cell specific marker scm0GFP (data not shown); (2) they fuse with the anterior seam cells to form the seam syncytium at the L4 stage like in wild-type; (3) they retain an eye-shaped morphology typical to the seam cells until seam syncytium formation as seen in Fig. 5. These data indicated that RNT-1 is required for some of the T cell functions, i.e. the asymmetrical (stem-like) cell division, but not for the seam cell differentiation." Paper_evidence: WBPaper00026860
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0005753 PATO:0000460 Paper_evidence: WBPaper00026860
                Curator_confirmed: WBPerson2987
      WBPhenotype:0001025 Paper_evidence: WBPaper00026860
        Curator_confirmed: WBPerson2987
        Remark: "rnt-1(tm388) has a deletion spanning from intron 3 to intron 4, resulting in a frame shift and a premature stop codon in the Runt domain (Fig. 1). Molecular data indicate rnt-1(tm388) is a null mutation. The tm388 transcript lacks the C-terminal half of the RNT-1 coding sequences, including residues critical for DNA recognition in the Runt domain. rnt-1(tm388) homozygous animals were viable and showed no gross morphological defects in hermaphrodites. However, the rnt-1(tm388) males showed striking phenotypes in which many copulatory rays in the tail were lost and the overall structure of the male tail was often destroyed (Fig. 2). rnt-1(tm388) males failed to mate with hermaphrodites (Table 1)." Paper_evidence: WBPaper00026860
            Curator_confirmed: WBPerson2987
        Variation_effect: Predicted_null_via_sequence: Paper_evidence: WBPaper00026860
            Curator_confirmed: WBPerson2987
  Reference (2)
  Remark: 13728/13729-14786/14787 (1058 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele