WormBase Tree Display for Variation: WBVar00249385

WBVar00249385 Name: Public_name: tm337
    HGVSg: CHROMOSOME_III:g.634210_634744del
  Sequence_details: SMap: S_parent: Sequence: W06E11
    Flanking_sequences: aacatctctgaacgcaacttcactgaattt agaaacgcgcaaagcttctcgtttgcgcac
    Mapping_target: W06E11
    Source_location: 7 CHROMOSOME_III 634209 634745 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm337_external
      tm337_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 337
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001412
    Transcript: T19C3.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-363
        CDS_position: ?-309
        Protein_position: ?-103
        Intron_number: 2/6
        Exon_number: 1-3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000478 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. I. Mori: weakly abnormal thermotaxis raised at 23 C but normal thermotaxis when raised at 17, 20 C. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: IK
        Temperature_sensitive: Heat_sensitive: 23 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as sterile and maternal by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
        Maternal
    Phenotype_not_observed: WBPhenotype:0000103 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. G. Hermann to the National Bioresource Project of Japan: wild-type gut granules. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: GH
  Remark: 28192/28193-28727/28728 (536 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target T19C3 updated based on the VEP analysis pipeline to W06E11.
  Method: NBP_knockout_allele