WormBase Tree Display for Variation: WBVar00249323

WBVar00249323 Name: Public_name: tm271
    HGVSg: CHROMOSOME_II:g.8703785_8704203del
  Sequence_details: SMap: S_parent: Sequence: C34C6
    Flanking_sequences: acgtggaattctggaggttgaagcttctgg ggaactctctttaaattcacaacttcattc
    Mapping_target: C34C6
    Source_location: 7 CHROMOSOME_II 8703784 8704204 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm271_external
      tm271_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 271
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000432
    Transcript: C34C6.8.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-45
        CDS_position: ?-45
        Protein_position: ?-15
        Exon_number: 1/3
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 31522/31523-31941/31942 (419 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele