WormBase Tree Display for Variation: WBVar00249317
expand all nodes | collapse all nodes | view schema
WBVar00249317 | Name | Public_name | tm265 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T26C11.7.1:c.1182_*424del | |||||||
HGVSg | CHROMOSOME_X:g.1853981_1854423del | |||||||
Sequence_details | SMap | S_parent | Sequence | T26C11 | ||||
Flanking_sequences | attttgaactgagcatctgaaaaatgtgtt | cccggttgattgtgatcaatggcgtgttcg | ||||||
Mapping_target | T26C11 | |||||||
Source_location | 7 | CHROMOSOME_X | 1853980 | 1854424 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm265_external | |||||||
tm265_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 265 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000460 | ||||||
Transcript | T26C11.7.1 | VEP_consequence | stop_lost,3_prime_UTR_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T26C11.7.1:c.1182_*424del | |||||||
cDNA_position | 1285-1727 | |||||||
CDS_position | 1182-? | |||||||
Protein_position | 394-? | |||||||
Exon_number | 6-7/7 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000070 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comment from Dr. D. Portman to the National Bioresource Project of Japan: male tail is morphologically wile-type. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Remark | 18501/18502-18944/18945 (443 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |