WormBase Tree Display for Variation: WBVar00249249
expand all nodes | collapse all nodes | view schema
| WBVar00249249 | Evidence | Paper_evidence | WBPaper00005198 | ||||
|---|---|---|---|---|---|---|---|
| Name (3) | |||||||
| Sequence_details | SMap | S_parent | Sequence | C09G9 | |||
| Flanking_sequences | cgcaacatcttccggaaatcgagtatctcc | gtgttgattgttaagcattccctgcacccg | |||||
| Mapping_target | C09G9 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005198 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TX | ||||||
| Status | Live | ||||||
| Affects (2) | |||||||
| Genetics | Interpolated_map_position | IV | 3.99874 | ||||
| Reference | WBPaper00005198 | ||||||
| Remark | both te26 and te41 have the g to a change in the predicted 5' UTR that creats an ATG upstream of the predicted translation start site [021017 ck1] | ||||||
| Method | Substitution_allele |
