WormBase Tree Display for Variation: WBVar00249024
expand all nodes | collapse all nodes | view schema
WBVar00249024 | Evidence | Paper_evidence | WBPaper00006247 | ||||||
---|---|---|---|---|---|---|---|---|---|
Author_evidence | Hui Y | ||||||||
Name | Public_name | sy628 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_V:g.6681403C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | K11G9 | |||||
Flanking_sequences | aacagtgttccctacacttccaatgttctg | aacccaacgctagttcaacagatgcttgcg | |||||||
Mapping_target | K11G9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006247 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030930 | ||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00006247 | |||||
Forward_genetics | altered expression of ceh-26::gfp in the HOB hook neuron | ||||||||
Genetics | Interpolated_map_position | V | 0.132827 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00006247 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00006247 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006247 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Genotype | chIs1200[ceh-26::gfp+dpy-20(+)] III; him-5(e1490) V h | Paper_evidence | WBPaper00006247 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000354 | Paper_evidence | WBPaper00053860 | |||||||
Curator_confirmed | WBPerson6578 | ||||||||
Remark | HSN differentiation deffects | Paper_evidence | WBPaper00053860 | ||||||
Curator_confirmed | WBPerson6578 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00053860 | ||||
Curator_confirmed | WBPerson6578 | ||||||||
GO_term | GO:0030182 | PATO:0000460 | Paper_evidence | WBPaper00053860 | |||||
Curator_confirmed | WBPerson6578 | ||||||||
WBPhenotype:0000649 | Paper_evidence | WBPaper00006247 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Paper_evidence | WBPaper00006247 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006247 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Genotype | chIs1200[ceh-26::gfp+dpy-20(+)] III; him-5(e1490) V h | Paper_evidence | WBPaper00006247 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001279 | Paper_evidence | WBPaper00006247 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Genotype | chIs1200[ceh-26::gfp+dpy-20(+)] III; him-5(e1490) V h | Paper_evidence | WBPaper00006247 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00006247 | ||||||||
WBPaper00053860 | |||||||||
Remark | egl-46(n1127) has similar Lov phenotype and regulation on HOB-specific gene expression | ||||||||
Method | Substitution_allele |