WormBase Tree Display for Variation: WBVar00249015
expand all nodes | collapse all nodes | view schema
WBVar00249015 | Evidence | Person_evidence | WBPerson191 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sy576 | ||||||
Other_name | CE24908:p.Pro159Leu | |||||||
F21F3.5.1:c.476C>T | ||||||||
HGVSg | CHROMOSOME_I:g.4900107G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F21F3 | ||||
Flanking_sequences | gtatgtgtcaaattgatgtaagatggttcc | gtttgatgagcaacaatgccatttgaaggt | ||||||
Mapping_target | F21F3 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00030888 | |||||||
WBStrain00030919 | ||||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006774 | ||||||
Transcript | F21F3.5.1 (12) | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | I | -0.650505 | |||||
Description | Phenotype | WBPhenotype:0000421 | Person_evidence | WBPerson191 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | spicule muscles resistant to 100mM levamisole | Person_evidence | WBPerson191 | |||||
Curator_confirmed | WBPerson48 | |||||||
Affected_by | Molecule | WBMol:00004019 | Person_evidence | WBPerson191 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson191 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Reference | WBPaper00029013 | |||||||
Remark | Isolation procedure: screen for males whose spicule muscles are resistant to 100mM levamisole | |||||||
Method | Substitution_allele |