WormBase Tree Display for Variation: WBVar00248986
expand all nodes | collapse all nodes | view schema
WBVar00248986 | Name | Public_name | sy428 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE38269:p.Arg180Ter | ||||||||
CE08039:p.Arg180Ter | |||||||||
CE38270:p.Arg180Ter | |||||||||
C09E10.2d.1:c.538C>T | |||||||||
C09E10.2e.1:c.538C>T | |||||||||
C09E10.2b.1:c.538C>T | |||||||||
C09E10.2c.1:c.538C>T | |||||||||
CE08038:p.Arg180Ter | |||||||||
C09E10.2a.1:c.538C>T | |||||||||
CE38268:p.Arg180Ter | |||||||||
HGVSg | CHROMOSOME_X:g.989709G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C09E10 | |||||
Flanking_sequences | tgcttctcaacggaatgccttgccggaatg | gatgtgaatggtgtggtcagacggttagtt | |||||||
Mapping_target | C09E10 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024616 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030867 | ||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000958 | |||||||
Transcript | C09E10.2d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09E10.2d.1:c.538C>T | ||||||||
HGVSp | CE38269:p.Arg180Ter | ||||||||
cDNA_position | 538 | ||||||||
CDS_position | 538 | ||||||||
Protein_position | 180 | ||||||||
Exon_number | 4/14 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
C09E10.2c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09E10.2c.1:c.538C>T | ||||||||
HGVSp | CE38268:p.Arg180Ter | ||||||||
cDNA_position | 538 | ||||||||
CDS_position | 538 | ||||||||
Protein_position | 180 | ||||||||
Exon_number | 4/14 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
C09E10.2a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09E10.2a.1:c.538C>T | ||||||||
HGVSp | CE08038:p.Arg180Ter | ||||||||
cDNA_position | 681 | ||||||||
CDS_position | 538 | ||||||||
Protein_position | 180 | ||||||||
Exon_number | 5/18 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
C09E10.2e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09E10.2e.1:c.538C>T | ||||||||
HGVSp | CE38270:p.Arg180Ter | ||||||||
cDNA_position | 538 | ||||||||
CDS_position | 538 | ||||||||
Protein_position | 180 | ||||||||
Exon_number | 4/15 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
C09E10.2b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09E10.2b.1:c.538C>T | ||||||||
HGVSp | CE08039:p.Arg180Ter | ||||||||
cDNA_position | 681 | ||||||||
CDS_position | 538 | ||||||||
Protein_position | 180 | ||||||||
Exon_number | 5/18 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000518038 | ||||||||
WBInteraction000542426 | |||||||||
WBInteraction000542430 | |||||||||
WBInteraction000542434 | |||||||||
WBInteraction000542438 | |||||||||
Genetics | Interpolated_map_position | X | -18.8693 | ||||||
Description | Phenotype | WBPhenotype:0000004 | Paper_evidence (2) | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Animals displayed an empty uterus. | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
"We evaluated this question by crossing the grk-2(gk268) and grk-2(rt97) alleles with strains that are constitutive egg layers. These strains include a gain-of-function strain that has activated Gαq (egl-30(ep271)) as well as loss-of-function strains that are defective in Gαo (goa-1(n1134)), the G protein that inhibits egg laying; EAT-16 (eat-16(ep273)), the regulator of G protein signaling (RGS) protein of Gαq; or diacylglycerol kinase (dgk-1(sy428)), a potential effector enzyme that phosphorylates diacylglycerol." (Figure 3A) | Paper_evidence | WBPaper00050796 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00050796 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0018991 | PATO:0002356 | Paper_evidence | WBPaper00050796 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Young well-fed animals were scored | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000016 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Measured by the fraction of animals moving after incubation on 0.1mM aldicarb agar pads. 0 animals were moving compared to ~0.79 N2 animals. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000019 | Paper_evidence | WBPaper00032082 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited reduced pumping rates similar to daf-7(e1372). | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Pumping rates were assayed for well-fed , pheromone-untreated; food-deprived, pheromone-untreated; and well-fed, pheromone-treated animals. Pheromone treatment consisted of transfer of animals grown under well-fed conditions to plates containing 30 ul/ml of a dauer-pheromone prep (Golden and Riddle, 1982) and 30 ml of OP50 E. coli food. | Paper_evidence | WBPaper00032082 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00032082 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dispersal index in the absence of anesthetic ~0.47 is decreased compared to N2 ~0.90. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed (4) | |||||||||
Reference | WBPaper00038270 | ||||||||
WBPaper00032082 | |||||||||
WBPaper00004721 | |||||||||
WBPaper00016916 | |||||||||
WBPaper00050796 | |||||||||
WBPaper00065340 | |||||||||
WBPaper00065992 | |||||||||
Method | Substitution_allele |