WormBase Tree Display for Variation: WBVar00248962
expand all nodes | collapse all nodes | view schema
WBVar00248962 | Evidence | Paper_evidence | WBPaper00026831 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sy290 | ||||||
Other_name (12) | ||||||||
HGVSg | CHROMOSOME_IV:g.7686702C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F33D4 | ||||
Flanking_sequences | attctaatgaatacaaatttgtttcaggtc | gcgatctggattttgcaaatgatgcatgca | ||||||
Mapping_target | F33D4 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026831 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (4) | ||||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002173 | ||||||
Transcript | F33D4.2d.1 (12) | |||||||
F33D4.2g.1 (12) | ||||||||
F33D4.2a.1 (12) | ||||||||
F33D4.2f.1 (12) | ||||||||
F33D4.2h.1 (12) | ||||||||
F33D4.2e.1 (12) | ||||||||
Interactor | WBInteraction000051431 | |||||||
WBInteraction000051432 | ||||||||
WBInteraction000052166 | ||||||||
WBInteraction000052169 | ||||||||
WBInteraction000519131 | ||||||||
WBInteraction000538566 | ||||||||
WBInteraction000576760 | ||||||||
WBInteraction000586251 | ||||||||
Genetics | Interpolated_map_position | IV | 3.37733 | |||||
Description | Phenotype | WBPhenotype:0000145 | Paper_evidence | WBPaper00003017 | ||||
Curator_confirmed | WBPerson625 | |||||||
Remark | suppresses let-23 sterilty (ovulation) | Paper_evidence | WBPaper00003017 | |||||
Curator_confirmed | WBPerson625 | |||||||
Phenotype_assay | Genotype | let-23(sy10) | Paper_evidence | WBPaper00003017 | ||||
Curator_confirmed | WBPerson625 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00042394 | ||||||
WBPaper00040692 | ||||||||
Curator_confirmed (2) | ||||||||
Remark | Decreased brood size compared to wildtype | Paper_evidence | WBPaper00042394 | |||||
Curator_confirmed | WBPerson1777 | |||||||
"... the weak itr-1 loss-of-function (LOF) allele sa73 reduces brood size by ~75%, while the itr-1 gain-of-function (GOF) allele sy290 reduces brood size by only ~25% (Figure 7A) [15,16]." | Paper_evidence | WBPaper00040692 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00040692 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000207 | Paper_evidence | WBPaper00028479 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 6A | Paper_evidence | WBPaper00028479 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000666 | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | |||||||
Remark | Do not exhibit overt ovulation or spermathecal transit defects; however, the sheath cell contractions are more frequent in these animals | Paper_evidence | WBPaper00042394 | |||||
Curator_confirmed | WBPerson1777 | |||||||
There were no detected changes in calcium dynamics, such as increased propagation speed nor increased frequency | Paper_evidence | WBPaper00042394 | ||||||
Curator_confirmed | WBPerson1777 | |||||||
Reference | WBPaper00040692 | |||||||
WBPaper00040893 | ||||||||
WBPaper00028479 | ||||||||
WBPaper00003017 | ||||||||
WBPaper00016949 | ||||||||
WBPaper00023320 | ||||||||
WBPaper00030553 | ||||||||
WBPaper00042394 | ||||||||
Method | Substitution_allele |