WormBase Tree Display for Variation: WBVar00248956

WBVar00248956 Evidence: Paper_evidence: WBPaper00002543
  Name: Public_name: sy277
    Other_name: Y71F9B.5a.2:c.22_92del
      CE25569:p.Ile8ArgfsTer3
      Y71F9B.5a.1:c.22_92del
      Y71F9B.5b.1:c.22_92del
      CE28810:p.Ile8ArgfsTer3
    HGVSg: CHROMOSOME_I:g.2707650_2708127del
  Sequence_details: SMap: S_parent: Sequence: Y71F9B
    Flanking_sequences: ttctccaaaatgatgcattctttgggcatc cgacattgagctatgcaaagacctgcccta
    Mapping_target: Y71F9B
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00030834
    Laboratory: PS
    Status: Live
  Affects: Gene: WBGene00003006
    Transcript: Y71F9B.5a.1 (11)
      Y71F9B.5b.1 (11)
      Y71F9B.5a.2 (11)
    Interactor: WBInteraction000002725
      WBInteraction000538502
  Genetics: Interpolated_map_position: I -7.44086
  Description: Phenotype (9)
  Reference (4)
  Remark: sy277 starts 51 bp upstream of SL1 splice site and ends in the second exon 26 bp downstream of the splice acceptor site. Feature: WBsf000261 was used as a reference to curate this information. Paper_evidence: WBPaper00002543
    Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003006 Genomic_neighbourhood Paper_evidence: WBPaper00002543
  Method: Deletion_allele